OAZ1 (NM_001301020) Human Untagged Clone

CAT#: SC333809

OAZ1 (untagged) - Human ornithine decarboxylase antizyme 1 (OAZ1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OAZ1
• Synonyms: AZ1; AZI; OAZ
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301020, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGAAATCCTCCCTGCAGCGGATCCTCAATAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGATAAAC
  CCAGCGCCACCATCCACGCCAGCCGCACCATGCCGCTCCTAAGCCTGCACAGCCGCGGCGGCAGCAGCAG
  TGAGAGGGTCTCCCTCCACTGCTGTAGTAACCCGGGTCCGGGGCCTCGGTGGTGCTCCATGGTGAAATCC
  TCCCTGCAGCGGATCCTCAATAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGATAAACCCAGCGCCACCA
  TCCACGCCAGCCGCACCATGCCGCTCCTAAGCCTGCACAGCCGCGGCGGCAGCAGCAGTGAGAGGGTCTC
  CCTCCACTGCTGTAGTAACCCGGGTCCGGGGCCTCGGTGGTGCTCC
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301020
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301020.1, NP_001287949.1
• RefSeq Size: 1189 bp
• RefSeq ORF: 396 bp
• Locus ID: 4946
• Cytogenetics: 19p13.3
• Gene Summary: 'The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 1, the first member of the antizyme family, that has broad tissue distribution, and negatively regulates intracellular polyamine levels by binding to and targeting ODC for degradation, as well as inhibiting polyamine uptake. Antizyme 1 mRNA contains two potential in-frame AUGs; and studies in rat suggest that alternative use of the two translation initiation sites results in N-terminally distinct protein isoforms with different subcellular localization. Alternatively spliced transcript variants have also been noted for this gene. [provided by RefSeq, Dec 2014]'
  Transcript Variant: This variant (2) uses an alternate, in-frame acceptor splice site at the second exon compared to variant 1. The resulting isoform (2) lacks 2 internal amino acids compared to isoform 1.