UBE2C (NM_001281741) Human Untagged Clone
CAT#: SC333811
UBE2C (untagged) - Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 7
"NM_001281741" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UBE2C |
Synonyms | dJ447F3.2; UBCH10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001281741, the custom clone sequence may differ by one or more nucleotides
ATGGCTTCCCAAAACCGCGACCCAGCCGCCACTAGCGTCGCCGCCGCCCGTAAAGGAGCTGAGCCGAGCG GGGGCGCCGCCCGGGGTCCGGTGGGCAAAAGGCTACAGCAGGAGCTGATGACCCTCATGGCAGTGGGGAG CATCAGAACCAGCTCAACAGTTTGTCTACTGTCCGGTCCCAGAGAAACTCAAGATTCTAGCAAGCCCCTT GTGTGGGGCTTGGGTTGGGACATGAGGCTGCTGCTGGAGCTTACTCTGCAACTGTTTCTCCAAATGCCAG AACCCAACATTGATAGTCCCTTGAACACACATGCTGCCGAGCTCTGGAAAAACCCCACAGCTTTTAAGAA GTACCTGCAAGAAACCTACTCAAAGCAGGTCACCAGCCAGGAGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281741 |
ORF Size | 399 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001281741.1, NP_001268670.1 |
RefSeq Size | 723 |
RefSeq ORF | 399 |
Locus ID | 11065 |
Protein Families | Druggable Genome |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is required for the destruction of mitotic cyclins and for cell cycle progression, and may be involved in cancer progression. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been defined on chromosomes 4, 14, 15, 18, and 19. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (7) has multiple differences in the central coding region but maintains the reading frame, compared to variant 1. The encoded isoform (6) is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235917 | UBE2C (myc-DDK-tagged) - Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 7 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review