CD252 (TNFSF4) (NM_001297562) Human Untagged Clone

CAT#: SC333815

TNFSF4 (untagged) - Human tumor necrosis factor (ligand) superfamily, member 4 (TNFSF4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNFSF4
• Synonyms: CD134L; CD252; GP34; OX-40L; OX4OL; TNLG2B; TXGP1
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297562, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTATCACATCGGTATCCTCGAATTCAAAGTATCAAAGTACAATTTACCGAATATAAGAAGGAGAAAG
  GTTTCATCCTCACTTCCCAAAAGGAGGATGAAATCATGAAGGTGCAGAACAACTCAGTCATCATCAACTG
  TGATGGGTTTTATCTCATCTCCCTGAAGGGCTACTTCTCCCAGGAAGTCAACATTAGCCTTCATTACCAG
  AAGGATGAGGAGCCCCTCTTCCAACTGAAGAAGGTCAGGTCTGTCAACTCCTTGATGGTGGCCTCTCTGA
  CTTACAAAGACAAAGTCTACTTGAATGTGACCACTGACAATACCTCCCTGGATGACTTCCATGTGAATGG
  CGGAGAACTGATTCTTATCCATCAAAATCCTGGTGAATTCTGTGTCCTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297562
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297562.1, NP_001284491.1
• RefSeq Size: 3442 bp
• RefSeq ORF: 402 bp
• Locus ID: 7292
• Cytogenetics: 1q25.1
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction
• Gene Summary: 'This gene encodes a cytokine of the tumor necrosis factor (TNF) ligand family. The encoded protein functions in T cell antigen-presenting cell (APC) interactions and mediates adhesion of activated T cells to endothelial cells. Polymorphisms in this gene have been associated with Sjogren's syndrome and systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]'
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.