Pirh2 (RCHY1) (NM_001278539) Human Untagged Clone

CAT#: SC333820

RCHY1 (untagged) - Human ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase (RCHY1), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RCHY1
• Synonyms: ARNIP; CHIMP; PIRH2; PRO1996; RNF199; ZCHY; ZNF363
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278539, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATCTTCAAGGAAGACACAAGTGTATTGAAAATGTGTCCCGACAGAATTGTCCAATATGTTTGGAGG
  ACATTCACACATCCCGTGTTGTTGCTCATGTCTTGCCATGTGGACATCTTTTACATAGAACGTGTTATGA
  AGAAATGTTGAAAGAAGGCTACAGATGTCCATTATGTATGCACTCTGCTTTAGATATGACCAGGTATTGG
  AGACAGCTGGATGATGAAGTAGCACAGACTCCTATGCCATCAGAATATCAGAACATGACTGTGGATATTC
  TCTGCAATGACTGTAATGGACGATCCACTGTTCAGTTTCATATATTAGGCATGAAATGTAAGATTTGTGA
  ATCCTATAATACTGCTCAAGCTGGAGGACGTAGAATTTCACTGGATCAGCAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278539
• ORF Size: 405 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001278539.1, NP_001265468.1
• RefSeq Size: 4469
• RefSeq ORF: 405
• Locus ID: 25898
• Protein Families: Druggable Genome, Stem cell - Pluripotency
• Protein Pathways: p53 signaling pathway, Ubiquitin mediated proteolysis
• Gene Summary: The protein encoded by this gene has ubiquitin ligase activity. It mediates E3-dependent ubiquitination and proteasomal degradation of target proteins, including tumor protein 53, histone deacetylase 1, and cyclin-dependent kinase inhibitor 1B, thus regulating their levels and cell cycle progression. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2013]
  Transcript Variant: This variant (9) uses an alternate splice site in the 5' terminal exon, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (7) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.