DHFR (NM_001290354) Human Untagged Clone

CAT#: SC333828

DHFR (untagged) - Human dihydrofolate reductase (DHFR), transcript variant 2


  "NM_001290354" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DHFR"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DHFR
Synonyms DHFRP1; DYR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290354, the custom clone sequence may differ by one or more nucleotides


ATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTC
TCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAA
ACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTAT
AAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGA
TGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001290354
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290354.1, NP_001277283.1
RefSeq Size 3882 bp
RefSeq ORF 408 bp
Locus ID 1719
Cytogenetics 5q14.1
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Folate biosynthesis, Metabolic pathways, One carbon pool by folate
Gene Summary 'Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]'
Transcript Variant: This variant (2) lacks an alternate exon in the 5' end compared to variant 1. This difference causes translation initiation at a downstream AUG and results in an isoform (2) with a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.