ARL 1 (ARL1) (NM_001301068) Human Untagged Clone

CAT#: SC333833

ARL1 (untagged) - Human ADP-ribosylation factor-like 1 (ARL1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARL1
• Synonyms: ARFL1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301068, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCATTGGATTTAATGTAGAGACGGTGACGTACAAAAACCTTAAATTCCAAGTCTGGGATTTAGGAG
  GACAGACAAGTATCAGGCCATACTGGAGATGTTACTATTCAAACACAGATGCAGTCATTTATGTAGTAGA
  CAGTTGTGACCGAGACCGAATTGGCATTTCCAAATCAGAGTTAGTTGCCATGTTGGAGGAAGAAGAGCTG
  AGAAAAGCCATTTTAGTGGTGTTTGCAAATAAACAGGACATGGAACAGGCCATGACTTCCTCAGAGATGG
  CAAATTCACTTGGGTTACCTGCCTTGAAGGACCGAAAATGGCAGATATTCAAAACGTCAGCAACCAAAGG
  CACCGGCCTTGATGAGGCAATGGAATGGTTAGTTGAAACATTAAAAAGCAGACAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301068
• ORF Size: 408 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301068.1, NP_001287997.1
• RefSeq Size: 3115
• RefSeq ORF: 408
• Locus ID: 400
• Gene Summary: The protein encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). ARFs, described as activators of cholera toxin (CT) ADP-ribosyltransferase activity, regulate intracellular vesicular membrane trafficking, and stimulate a phospholipase D (PLD) isoform. Although, ARL proteins were initially thought not to activate CT or PLD, later work showed that they are weak stimulators of PLD and CT in a phospholipid dependent manner. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.