TSPAN6 (NM_001278742) Human Untagged Clone

CAT#: SC333848

TSPAN6 (untagged) - Human tetraspanin 6 (TSPAN6), transcript variant 4


  "NM_001278742" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TSPAN6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TSPAN6
Synonyms T245; TM4SF6; TSPAN-6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278742, the custom clone sequence may differ by one or more nucleotides


ATGCTAAAACTGTATGCAATGTTTCTGACTCTCGTTTTTTTGGTCGAACTGGTCGCTGCCATCGTAGGAT
TTGTTTTCAGACATGAGATTAAGAACAGCTTTAAGAATAATTATGAGAAGGCTTTGAAGCAGTATAACTC
TACAGGAGATTATAGAAGCCATGCAGTAGACAAGATCCAAAATACGTTGCATTGTTGTGGTGTCACCGAT
TATAGAGATTGGACAGATACTAATTATTACTCAGAAAAAGGATTTCCTAAGAGTTGCTGTAAACTTGAAG
ATTGTACTCCACAGAGAGATGCAGACAAAGTAAACAATGAAGGTTGTTTTATAAAGGTGATGACCATTAT
AGAGTCAGAAATGGGAGTCGTTGCAGGAATTTCCTTTGGAGTTGCTTGCTTCCAAGACATTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001278742
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278742.1, NP_001265671.1
RefSeq Size 3787 bp
RefSeq ORF 414 bp
Locus ID 7105
Cytogenetics Xq22.1
Protein Families Transmembrane
Gene Summary 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The protein encoded by this gene is a cell surface glycoprotein and is highly similar in sequence to the transmembrane 4 superfamily member 2 protein. It functions as a negative regulator of retinoic acid-inducible gene I-like receptor-mediated immune signaling via its interaction with the mitochondrial antiviral signaling-centered signalosome. This gene uses alternative polyadenylation sites, and multiple transcript variants result from alternative splicing. [provided by RefSeq, Jul 2013]'
Transcript Variant: This variant (4) differs in its 5' UTR, lacks a portion of the 5' coding region, uses a downstream in-frame start codon, and lacks an exon that results in an alternate 3' coding region, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus and contains a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.