PPCS (NM_001287508) Human Untagged Clone

CAT#: SC333855

PPCS (untagged) - Human phosphopantothenoylcysteine synthetase (PPCS), transcript variant 5


  "NM_001287508" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPCS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPCS
Synonyms CMD2C
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001287508, the custom clone sequence may differ by one or more nucleotides


ATGTTTTACCTGGCTGCGGCTGTGTCAGATTTCTATGTTCCTGTCTCTGAAATGCCTGAACACAAGATCC
AGTCATCTGGGGGCCCACTGCAGATAACAATGAAGATGGTGCCAAAACTGCTTTCTCCTTTGGTTAAAGA
TTGGGCTCCCAAAGCATTTATAATTTCCTTTAAGTTGGAGACTGACCCCGCCATTGTAATTAATCGAGCT
CGGAAGGCTTTGGAAATTTATCAGCATCAAGTGGTGGTGGCTAATATCCTTGAGTCACGACAGTCCTTTG
TGTTTATTGTAACCAAAGACTCGGAAACCAAGTTATTGCTATCAGAGGAAGAAATAGAAAAAGGCGTAGA
GATAGAAGAGAAGATAGTGGATAATCTTCAGTCTCGACACACAGCTTTTATAGGTGACAGAAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287508
ORF Size 417 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001287508.1, NP_001274437.1
RefSeq Size 1963
RefSeq ORF 417
Locus ID 79717
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis
Gene Summary Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCS (EC 6.3.2.5), one of the last enzymes in this pathway, converts phosphopantothenate to phosphopantothenoylcysteine (Daugherty et al., 2002 [PubMed 11923312]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (5) uses an alternate splice junction at the 3' end of the first exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, 5, 6, and 7 all encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.