Kallikrein 8 (KLK8) (NM_001281431) Human Untagged Clone
CAT#: SC333860
KLK8 (untagged) - Human kallikrein-related peptidase 8 (KLK8), transcript variant 5
"NM_001281431" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KLK8 |
Synonyms | HNP; NP; NRPN; PRSS19; TADG14 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001281431, the custom clone sequence may differ by one or more nucleotides
ATGCTTCTTCAACTGCGTGACCAGGCATCCCTGGGGTCCAAAGTGAAGCCCATCAGCCTGGCAGATCATT GCACCCAGCCTGGCCAGAAGTGCACCGTCTCAGGCTGGGGCACTGTCACCAGTCCCCGAGAGAATTTTCC TGACACTCTCAACTGTGCAGAAGTAAAAATCTTTCCCCAGAAGAAGTGTGAGGATGCTTACCCGGGGCAG ATCACAGATGGCATGGTCTGTGCAGGCAGCAGCAAAGGGGCTGACACGTGCCAGGGCGATTCTGGAGGCC CCCTGGTGTGTGATGGTGCACTCCAGGGCATCACATCCTGGGGCTCAGACCCCTGTGGGAGGTCCGACAA ACCTGGCGTCTATACCAACATCTGCCGCTACCTGGACTGGATCAAGAAGATCATAGGCAGCAAGGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281431 |
ORF Size | 420 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001281431.1, NP_001268360.1 |
RefSeq Size | 863 |
RefSeq ORF | 420 |
Locus ID | 11202 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in tandem in a gene cluster on chromosome 19. The encoded protein may be involved in proteolytic cascade in the skin and may serve as a biomarker for ovarian cancer. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (5, also known as T5) lacks an alternate exon in the 5' coding region and initiates translation at a downstream start codon, compared to variant 2. It encodes isoform 5 which is shorter at the N-terminus, compared to isoform 2. This variant is based on data in PMID: 20360129. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235966 | KLK8 (myc-DDK-tagged) - Human kallikrein-related peptidase 8 (KLK8), transcript variant 5 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review