SNX3 (NM_001300929) Human Untagged Clone

CAT#: SC333870

SNX3 (untagged) - Human sorting nexin 3 (SNX3), transcript variant 4


  "NM_001300929" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SNX3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SNX3
Synonyms Grd19; MCOPS8; SDP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300929, the custom clone sequence may differ by one or more nucleotides


ATGGCGGAGACCGTGGCTGACACCCGGCGGCTGATCACCAAGCCGCAGAACCTGAATGACGCCTACGGAC
CCCCCAGCAACTTCCTCGAGATCGATACAAATCTTCCTATTTTCAAGCTGAAAGAATCTACTGTTAGAAG
AAGATACAGTGACTTTGAATGGCTGCGAAGTGAATTAGAAAGAGAGAGCAAGGTCGTAGTTCCCCCGCTC
CCTGGGAAAGCGTTTTTGCGTCAGCTTCCTTTTAGAGGAGATGATGGAATATTTGATGACAATTTTATTG
AGGAAAGAAAACAAGGGCTGGAGCAGTTTATAAACAAGGTCGCTGGTCATCCTCTGGCACAGAACGAACG
TTGTCTTCACATGTTTTTACAAGATGAAATAATAGATAAAAGCTATACTCCATCTAAAATAAGACATGCC
TGA


Restriction Sites SgfI-MluI     
ACCN NM_001300929
ORF Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001300929.1, NP_001287858.1
RefSeq Size 1711
RefSeq ORF 423
Locus ID 8724
Gene Summary This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like most family members. This protein interacts with phosphatidylinositol-3-phosphate, and is involved in protein trafficking. A pseudogene of this gene is present on the sex chromosomes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) lacks an in-frame portion of the first coding exon, compared to variant 1. It encodes isoform d, which is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.