MDMX (MDM4) (NM_001278516) Human Untagged Clone

CAT#: SC333873

MDM4 (untagged) - Human MDM4, p53 regulator (MDM4), transcript variant 4


  "NM_001278516" in other vectors (1)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MDM4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MDM4
Synonyms HDMX; MDMX; MRP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278516, the custom clone sequence may differ by one or more nucleotides


ATGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAAA
TCAATCAGGTACGACCAAAACTGCCGCTTTTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTT
CACTGTTAAAGAGGTCATGCACTATTTAGGTCAGTACATAATGGTGAAGCAACTTTATGATCAGCAGGAG
CAGCATATGGTATATTGTGGTGGAGATCTTTTGGGAGAACTACTGGGACGTCAGAGCTTCTCCGTGAAAG
ACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTTAGCCACTGCTACTACAGCAAAGTG
CAGAGGAAAGTTCCACTTCCAGAAAAAGAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCA
TAA


Restriction Sites SgfI-MluI     
ACCN NM_001278516
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278516.1, NP_001265445.1
RefSeq Size 10022 bp
RefSeq ORF 423 bp
Locus ID 4194
Cytogenetics 1q32.1
Protein Families Druggable Genome, Transcription Factors
Protein Pathways p53 signaling pathway
Gene Summary 'This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Feb 2011]'
Transcript Variant: This variant (4, also known as MDM4-S, HDMX-S, or HDMX-E) lacks an internal coding exon compared to variant 1. The resulting isoform (4) has a much shorter and alternate C-terminus compared to isoform 1. Annotation of this protein causes this transcript to be a candidate for nonsense-mediated mRNA decay (NMD); however, this protein was shown in PMID: 10075736 to be biologically valid. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.