EDF1 (NM_001281297) Human Untagged Clone
CAT#: SC333884
EDF1 (untagged) - Human endothelial differentiation-related factor 1 (EDF1), transcript variant 3
"NM_001281297" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EDF1 |
Synonyms | CFAP280; EDF-1; MBF1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001281297, the custom clone sequence may differ by one or more nucleotides
ATGGCCGAGAGCGACTGGGACACGGTGACGGTGCTGCGCAAGAAGGGCCCTACGGCCGCCCAGGCCAAAT CCAAGCAGGCTATCTTAGCGGCACAGAGACGAGGAGAAGATGTGGAGACTTCCAAGAAATGGGCTGCTGG CCAGAACAAACAACATTCTATTACCAAGAACACGGCCAAGCTGGACCGGGAGACAGAGGAGCTGCACCAT GACAGGGTGACCCTGGAGGTGGGCAAGGTGATCCAGCAAGGTCGGCAGAGCAAGGGGCTTACGCAGAAGG ACCTGGCCACGAAAATCAATGAGAAGCCACAGGTGATCGCGGACTATGAGAGCGGACGGGCCATACCCAA TAACCAGGTGCTTGGCAAAATCGAGCGGGCCATTGATGTGGGAACCAGGAGTGCTCGTGTGCTGAGAGCC CAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281297 |
ORF Size | 426 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001281297.1, NP_001268226.1 |
RefSeq Size | 852 |
RefSeq ORF | 426 |
Locus ID | 8721 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a protein that may regulate endothelial cell differentiation, lipid metabolism, and hormone-induced cardiomyocyte hypertrophy. The encoded protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (3) uses an alternate splice site in the 3'-terminal exon, which leads to a translational frameshift, compared to variant alpha. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform alpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235990 | EDF1 (myc-DDK-tagged) - Human endothelial differentiation-related factor 1 (EDF1), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review