Neuritin (NRN1) (NM_001278710) Human Untagged Clone

CAT#: SC333888

NRN1 (untagged) - Human neuritin 1 (NRN1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NRN1
• Synonyms: dJ380B8.2; NRN
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278710, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGACTTAAGTTGAACGGCAGATATATTTCACTGATCCTCGCGGTGCAAATAGCGTATCTGGTGCAGG
  CCGTGAGAGCAGCGGGCAAGTGCGATGCGGTCTTCAAGGGCTTTTCGGACTGTTTGCTCAAGCTGGGCGA
  CAGCATGGCCAACTACCCGCAGGGCCTGGACGACAAGACGAACATCAAGACCGTGTGCACATACTGGGAG
  GATTTCCACAGCTGCACGGTCACAGCCCTTACGGATTGCCAGGAAGGGGCGAAAGATATGTGGGATAAAC
  TGAGAAAAGAATCCAAAAACCTCAACATCCAAGGCAGCTTATTCGAACTCTGCGGCAGCGGCAACGGGGC
  GGCGGGGTCCCTGCTCCCGGCGTTCCCGGTGCTCCTGGTGTCTCTCTCGGCAGCTTTAGCGACCTGGCTT
  TCCTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278710
• ORF Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001278710.1, NP_001265639.1
• RefSeq Size: 1574
• RefSeq ORF: 429
• Locus ID: 51299
• Gene Summary: This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1).