C21orf7 (MAP3K7CL) (NM_001286618) Human Untagged Clone

CAT#: SC333896

MAP3K7CL (untagged) - Human MAP3K7 C-terminal like (MAP3K7CL), transcript variant 4


  "NM_001286618" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAP3K7CL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAP3K7CL
Synonyms C21orf7; HC21ORF7; TAK1L; TAKL; TAKL-1; TAKL-2; TAKL-4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286618, the custom clone sequence may differ by one or more nucleotides


ATGATCAGCACAGCCAGGGTACCTGCTGACAAGCCTGTACGCATCGCCTTTAGCCTCAATGACGCCTCAG
ATGATACACCCCCTGAAGACTCCATTCCTTTGGTCTTTCCAGAATTAGACCAGCAGCTACAGCCCCTGCC
GCCTTGTCATGACTCCGAGGAATCCATGGAGGTGTTCAAACAGCACTGCCAAATAGCAGAAGAATACCAT
GAGGTCAAAAAGGAAATCACCCTGCTTGAGCAAAGGAAGAAGGAGCTCATTGCCAAGTTAGATCAGGCAG
AAAAGGAGAAGGTGGATGCTGCTGAGCTGGTTCGGGAATTCGAGGCTCTGACGGAGGAGAATCGGACGTT
GAGGTTGGCCCAGTCTCAATGTGTGGAACAACTGGAGAAACTTCGAATACAGTATCAGAAGAGGCAGGGC
TCGTCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001286618
ORF Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001286618.1, NP_001273547.1
RefSeq Size 2140
RefSeq ORF 429
Locus ID 56911
Protein Families Transcription Factors

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.