PGRMC1 (NM_001282621) Human Untagged Clone

CAT#: SC333901

PGRMC1 (untagged) - Human progesterone receptor membrane component 1 (PGRMC1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGRMC1
• Synonyms: Dap1; HPR6.6; IZA; MPR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282621, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCCGAGGATGTGGTGGCGACTGGCGCCGACCCAAGCGATCTGGAGAGCGGCGGGCTGCTGCATG
  AGATTTTCACGTCGCCGCTCAACCTGCTGCTGCTTGGCCTCTGCATCTTCCTGCTCTACAAGATCGTGCG
  CGGGGACCAGCCGGCGGCCAGCGGCGACAGCGACGACGACGAGCCGCCCCCTCTGCCCCGCCTCAAGCGG
  CGCGACTTCACCCCCGCCGAGCTGCGGCGCTTCGACGGCGTCCAGGACCCGCGCATACTCATGGCCATCA
  ACGGCAAGGTGTTCGATGTGACCAAAGGCCGCAAATTCTACGGGCCCGTCAAGTATCATCACGTGGGCAA
  ACTGCTGAAGGAGGGGGAGGAGCCCACTGTGTACTCAGATGAGGAAGAACCAAAAGATGAGAGTGCCCGG
  AAAAATGATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282621
• ORF Size: 432 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282621.1, NP_001269550.1
• RefSeq Size: 1772
• RefSeq ORF: 432
• Locus ID: 10857
• Protein Families: Druggable Genome, Nuclear Hormone Receptor, Transmembrane
• Gene Summary: This gene encodes a putative membrane-associated progesterone steroid receptor. The protein is expressed predominantly in the liver and kidney. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1.