Cystatin C (CST3) (NM_001288614) Human Untagged Clone
CAT#: SC333931
CST3 (untagged) - Human cystatin C (CST3), transcript variant 2
"NM_001288614" in other vectors (1)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CST3 |
| Synonyms | ARMD11; HEL-S-2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001288614, the custom clone sequence may differ by one or more nucleotides
ATGGCCGGGCCCCTGCGCGCCCCGCTGCTCCTGCTGGCCATCCTGGCCGTGGCCCTGGCCGTGAGCCCCG CGGCCGGCTCCAGTCCCGGCAAGCCGCCGCGCCTGGTGGGAGGCCCCATGGACGCCAGCGTGGAGGAGGA GGGTGTGCGGCGTGCACTGGACTTTGCCGTCGGCGAGTACAACAAAGCCAGCAACGACATGTACCACAGC CGCGCGCTGCAGGTGGTGCGCGCCCGCAAGCAGATCGTAGCTGGGGTGAACTACTTCTTGGACGTGGAGC TGGGCCGAACCACGTGTACCAAGACCCAGCCCAACTTGGACAACTGCCCCTTCCATGACCAGCCACATCT GAAAAGGAAAGCATTCTGCTCTTTCCAGATCTACGCTGTGCCTTGGCAGGGCACAATGACCTTGTCGAAA TCCACCTGTCAGGACGCCTAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001288614 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001288614.1, NP_001275543.1 |
| RefSeq Size | 2209 bp |
| RefSeq ORF | 441 bp |
| Locus ID | 1471 |
| Cytogenetics | 20p11.21 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transmembrane |
| Gene Summary | 'The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes the most abundant extracellular inhibitor of cysteine proteases, which is found in high concentrations in biological fluids and is expressed in virtually all organs of the body. A mutation in this gene has been associated with amyloid angiopathy. Expression of this protein in vascular wall smooth muscle cells is severely reduced in both atherosclerotic and aneurysmal aortic lesions, establishing its role in vascular disease. In addition, this protein has been shown to have an antimicrobial function, inhibiting the replication of herpes simplex virus. Alternative splicing results in multiple transcript variants encoding a single protein. [provided by RefSeq, Nov 2014]' Transcript Variant: This variant (2) represents the longer variant. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC236037 | CST3 (myc-DDK-tagged) - Human cystatin C (CST3), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China