CEBP Beta (CEBPB) (NM_001285879) Human Untagged Clone

CAT#: SC333947

CEBPB (untagged) - Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB), transcript variant 1


  "NM_001285879" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CEBPB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CEBPB
Synonyms C/EBP-beta; IL6DBP; NF-IL6; TCF5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001285879, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGGCTTCCCGTACGCGCTGCGCGCTTACCTCGGCTACCAGGCGGTGCCGAGCGGCAGCAGCG
GGAGCCTCTCCACGTCCTCCTCGTCCAGCCCGCCCGGCACGCCGAGCCCCGCTGACGCCAAGGCGCCCCC
GACCGCCTGCTACGCGGGGGCCGCGCCGGCGCCCTCGCAGGTCAAGAGCAAGGCCAAGAAGACCGTGGAC
AAGCACAGCGACGAGTACAAGATCCGGCGCGAGCGCAACAACATCGCCGTGCGCAAGAGCCGCGACAAGG
CCAAGATGCGCAACCTGGAGACGCAGCACAAGGTCCTGGAGCTCACGGCCGAGAACGAGCGGCTGCAGAA
GAAGGTGGAGCAGCTGTCGCGCGAGCTCAGCACCCTGCGGAACTTGTTCAAGCAGCTGCCCGAGCCCCTG
CTCGCCTCCTCCGGCCACTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001285879
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285879.1, NP_001272808.1
RefSeq Size 2113 bp
RefSeq ORF 444 bp
Locus ID 1051
Cytogenetics 20q13.13
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Gene Summary 'This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. [provided by RefSeq, Oct 2013]'
Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform [c, also known as LIP (liver inhibitory protein)] represented in this RefSeq results from translation initiation at a downstream AUG start codon. Isoform c has a shorter N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.