NMU (NM_001292046) Human Untagged Clone
CAT#: SC333966
NMU (untagged) - Human neuromedin U (NMU), transcript variant 3
"NM_001292046" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NMU |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001292046, the custom clone sequence may differ by one or more nucleotides
ATGCTGCGAACAGAGAGCTGCCGCCCCAGGTCGCCCGCCGGACAGGTGGCCGCGGCGTCCCCGCTCCTGC TGCTGCTGCTGCTGCTCGCCTGGTGCGCGGGCGCCTGCCGAGGTGCTCCAATATTACCTCAAGGATTACA GCCTGAACAACAGCTACAGTTGTGGAATGAGATAGATGATACTTGTTCGTCTTTTCTGTCCATTGATTCT CAGCCTCAGGCATCCAACGCACTGGAGGAGCTTTGCTTTATGATTATGGGAATGCTACCAAAGCCTCAGG AACAAGATGAAAAAGATAATACTAAAAGGTTCTTATTTCATTATTCGAAGACACAGAAGTTGGGCAAGTC AAATGTTGTGGAAGAATTCCAAAGTCCCTTTGCAAGTCAAAGTCGAGGATATTTTTTATTCAGGCCACGG AATGGAAGAAGGTCAGCAGGGTTCATTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001292046 |
ORF Size | 450 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001292046.1, NP_001278975.1 |
RefSeq Size | 759 |
RefSeq ORF | 450 |
Locus ID | 10874 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Gene Summary | This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in pain, stress, immune-mediated inflammatory diseases and feeding regulation. Increased expression of this gene was observed in renal, pancreatic and lung cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. Some of these isoforms may undergo similar processing to generate the mature peptide. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 3, which lacks an internal segment and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236072 | NMU (myc-DDK-tagged) - Human neuromedin U (NMU), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review