CHCHD10 (NM_001301339) Human Untagged Clone

CAT#: SC333967

CHCHD10 (untagged) - Human coiled-coil-helix-coiled-coil-helix domain containing 10 (CHCHD10), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHCHD10
• Synonyms: C22orf16; FTDALS2; IMMD; MIX17A; N27C7-4; SMAJ
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301339, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTCGGGGAAGCCGCAGCGCGGCCTCCCGGCCAGCCAGCCGCCCAGCCGCGCCCTCTGCCCACCCGC
  CCGCGCACCCACCGCCCTCGGCAGCCGCCCCAGCCCCCGCCCCTTCGGGCCAGCCGGGGCTCATGGCTCA
  GATGGCGACCACGGCCGCAGGGGTAGCCGTGGGCTCGGCTGTGGGACACGTCATGGGCAGCGCCCTGACC
  GGAGCCTTCAGCGGGGGGAGCTCGGAGCCCTCCCAGCCTGCTGTCCAGCAGCCTCTTGCACTGTACCCCC
  AGGCCCCCACCCCCGCTGCCCCCCAGCCCCTGCAGATGGGGCCCTGCGCCTACGAGATCAGGCAGTTCCT
  GGACTGTTCCACCACTCAGAGTGACCTGTCCCTGTGTGAGGGCTTCAGCGAGGCCCTGAAGCAGTGCAAG
  TACTACCATGGTCTGAGCTCCCTGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301339
• ORF Size: 450 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301339.1, NP_001288268.1
• RefSeq Size: 739
• RefSeq ORF: 450
• Locus ID: 400916
• Gene Summary: This gene encodes a mitochondrial protein that is enriched at cristae junctions in the intermembrane space. It may play a role in cristae morphology maintenance or oxidative phosphorylation. Mutations in this gene cause frontotemporal dementia and/or amyotrophic lateral sclerosis-2. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 7 and 19. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a).