SLAMF7 (NM_001282593) Human Untagged Clone

CAT#: SC333968

SLAMF7 (untagged) - Human SLAM family member 7 (SLAMF7), transcript variant 7


  "NM_001282593" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLAMF7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLAMF7
Synonyms 19A; CD319; CRACC; CS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282593, the custom clone sequence may differ by one or more nucleotides


ATGGCTGGTTCCCCAACATGCCTCACCCTCATCTATATCCTTTGGCAGCTCACAGAGCACCTGTCAAAGC
CTAAAGTCACCATGGGTCTGCAGAGCAATAAGAATGGCACCTGTGTGACCAATCTGACATGCTGCATGGA
ACATGGGGAAGAGGATGTGATTTATACCTGGAAGGCCCTGGGGCAAGCAGCCAATGAGTCCCATAATGGG
TCCATCCTCCCCATCTCCTGGAGATGGGGAGAAAGTGATATGACCTTCATCTGCGTTGCCAGGAACCCTG
TCAGCAGAAACTTCTCAAGCCCCATCCTTGCCAGGAAGCTCTGTGAAGAGAACAATCCTAAAGGAAGATC
CAGCAAATACGGTTTACTCCACTGTGGAAATACCGAAAAAGATGGAAAATCCCCACTCACTGCTCACGAT
GCCAGACACACCAAGGCTATTTGCCTATGA


Restriction Sites SgfI-MluI     
ACCN NM_001282593
ORF Size 450 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001282593.1, NP_001269522.1
RefSeq Size 2363
RefSeq ORF 450
Locus ID 57823
Protein Families Druggable Genome, Transmembrane
Gene Summary Isoform 3 does not mediate any NK cell activation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) lacks an alternate in-frame exon in the 5' coding region, and also lacks two alternate exons that result in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (g) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.