RANBP1 (NM_001278641) Human Untagged Clone

CAT#: SC333973

RANBP1 (untagged) - Human RAN binding protein 1 (RANBP1), transcript variant 4


  "NM_001278641" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "RANBP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RANBP1
Synonyms HTF9A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278641, the custom clone sequence may differ by one or more nucleotides


ATGCGGGCAAAACTGTTCCGATTTGCCTCTGAGAACGATCTCCCAGAATGGAAGGAGCGAGGCACTGGTG
ACGTCAAGCTCCTGAAGCACAAGGAGAAAGGGGCCATCCGCCTCCTCATGCGGAGGGACAAGACCCTGAA
GATCTGTGCCAACCACTACATCACGCCGATGATGGAGCTGAAGCCCAACGCAGGTAGCGACCGTGCCTGG
GTCTGGAACACCCACGCTGACTTCGCCGACGAGTGCCCCAAGCCAGAGCTGCTGGCCATCCGCTTCCTGA
ATGCTGAGAATGCACAGAAATTCAAAACAAAGTTTGAAGAATGCAGGAAAGAGATCGAAGAGAGAGAAAA
GAAAGGATCAGGCAAAAATGATCATGCCGAAAAAGTGGCGGAAAAGCTAGAAGCTCTCTCGGTGAAGGAG
GAGACCAAGGAGGATGCTGAGGAGAAGCAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001278641
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278641.1, NP_001265570.1
RefSeq Size 1254 bp
RefSeq ORF 453 bp
Locus ID 5902
Cytogenetics 22q11.21
Gene Summary 'This gene encodes a protein that forms a complex with Ras-related nuclear protein (Ran) and metabolizes guanoside triphosphate (GTP). This complex participates in the regulation of the cell cycle by controlling transport of proteins and nucleic acids into the nucleus. There are multiple pseudogenes for this gene on chromosomes 9, 12, 17, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]'
Transcript Variant: This variant (4) contains multiple differences, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (4) is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.