NME4 (NM_001286433) Human Untagged Clone

CAT#: SC333992

NME4 (untagged) - Human NME/NM23 nucleoside diphosphate kinase 4 (NME4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NME4
• Synonyms: NDPK-D; nm23-H4; NM23H4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001286433, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGGGCTGCGCTGCGGCCCGCGGGCCCCGGGCCCGAGCC
  TGCTAGTGCGCCACGGCTCGGGAGGGCCCTCCTGGACCCGGGAGCGGACCCTGGTGGCGGTGAAGCCCGA
  TGGCGTGCAACGGCGGCTCGTTGGGGACGTGATCCAGCGCTTTGAGAGGCGGGGCTTCACGCTGGTGGGG
  ATGAAGATGCTGCAGGTCTGGGAAGGGTACAATGTCGTCCGCGCCTCGAGGGCCATGATTGGACACACCG
  ACTCGGCTGAGGCTGCCCCAGGAACCATAAGGGGTGACTTCAGCGTCCACATCAGCAGGAATGTCATCCA
  CGCCAGCGACTCCGTGGAGGGGGCCCAGCGGGAGATCCAGCTGTGGTTCCAGAGCAGTGAGCTGGTGAGC
  TGGGCAGACGGGGGCCAGCACAGCAGCATCCACCCAGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286433
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286433.1, NP_001273362.1
• RefSeq Size: 957 bp
• RefSeq ORF: 462 bp
• Locus ID: 4833
• Cytogenetics: 16p13.3
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Purine metabolism, Pyrimidine metabolism
• Gene Summary: 'The nucleoside diphosphate (NDP) kinases (EC 2.7.4.6) are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates. The enzymes are products of the nm23 gene family, which includes NME4 (Milon et al., 1997 [PubMed 9099850]).[supplied by OMIM, May 2008]'
  Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.