Flt3 ligand (FLT3LG) (NM_001278638) Human Untagged Clone

CAT#: SC333998

FLT3LG (untagged) - Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 5


  "NM_001278638" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "FLT3LG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FLT3LG
Synonyms FL; FLG3L; FLT3L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278638, the custom clone sequence may differ by one or more nucleotides


ATGGAGCGGCTCAAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGCTGGAGCGCGTGAACACGGAGATAC
ACTTTGTCACCAAATGTGCCTTTCAGCCCCCCCCCAGCTGTCTTCGCTTCGTCCAGACCAACATCTCCCG
CCTCCTGCAGGAGACCTCCGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCCGG
TGCCTGGAGCTGCAGTGTCAGCCCGACTCCTCAACCCTGCCACCCCCATGGAGTCCCCGGCCCCTGGAGG
CCACAGCCCCGACAGCCCCGCAGCCCCCTCTGCTCCTCCTACTGCTGCTGCCCGTGGGCCTCCTGCTGCT
GGCCGCTGCCTGGTGCCTGCACTGGCAGAGGACGCGGCGGAGGACACCCCGCCCTGGGGAGCAGGTGCCC
CCCGTCCCCAGTCCCCAGGACCTGCTGCTTGTGGAGCACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278638
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278638.1, NP_001265567.1
RefSeq Size 1091 bp
RefSeq ORF 462 bp
Locus ID 2323
Cytogenetics 19q13.33
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Pathways in cancer
Gene Summary 'Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3LG controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 (see MIM 186910)-positive classical DCs and their CD103 (ITGAE; MIM 604682)-positive tissue counterparts (summary by Sathaliyawala et al., 2010 [PubMed 20933441]).[supplied by OMIM, Jan 2011]'
Transcript Variant: This variant (5) uses an alternate splice site in the 5' UTR which results in the use of a downstream AUG compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Variants 4 and 5 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.