RNF86 (TRIM2) (NM_001302694) Human Untagged Clone
CAT#: SC334004
TRIM2 (untagged) - Human tripartite motif containing 2 (TRIM2), transcript variant 5
"NM_001302694" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TRIM2 |
Synonyms | CMT2R; RNF86 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001302694, the custom clone sequence may differ by one or more nucleotides
ATGCAGCAGCGTGCAGGGTCAAAGACAGCCGGCCCCCCATGTCAGTGGTCTAGGATGGCCAGTGAAGGCA CCAACATCCCAAGTCCTGTGGTGCGCCAGATTGACAAGCAGTTTCTGATTTGCAGTATATGCCTGGAACG GTACAAGAATCCCAAGGTTCTCCCCTGTCTGCACACTTTCTGCGAGAGGTGCCTGCAGAACTACATTCCT GCCCACAGTTTAACCCTCTCCTGCCCAGTGTGCCGCCAGACCTCCATCCTGCCCGAGAAAGGGGTGGCCG CGCTCCAGAACAATTTCTTCATCACAAACCTGATGGACGTGCTGCAGCGAACTCCAGGCAGCAACGCTGA GGAGTCTTCCATCCTGGAGACAGTCACTGCTGTGGCTGCGGGAAAGCCTCTCTCTTGCCCAAACCACGAT GGGAATGTAAGTGGCTGGGATGGCAGATACTGCCCGGGAGCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302694 |
ORF Size | 465 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001302694.1, NP_001289623.1 |
RefSeq Size | 831 |
RefSeq ORF | 465 |
Locus ID | 23321 |
Gene Summary | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (5) contains alternate 5' and 3' terminal exons and lacks several other 3' exons, and it thus differs in both UTRs and in the 5' and 3' coding regions, compared to variant 1. The encoded isoform (5) has distinct N- and C-termini and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236110 | TRIM2 (myc-DDK-tagged) - Human tripartite motif containing 2 (TRIM2), transcript variant 5 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review