ISCU (NM_001301140) Human Untagged Clone

CAT#: SC334005

ISCU (untagged) - Human iron-sulfur cluster assembly enzyme (ISCU), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ISCU
• Synonyms: 2310020H20Rik; HML; hnifU; ISU2; NIFU; NIFUN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301140, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCGGCTGGGGCTTTCCGTCTGAGGCGGGCGGCATCGGCTCTGCTGCTGCGGAGCCCCCGCCTGC
  CCGCCCGGGAGCTGTCGGCCCCGGCCCGACTCTATCACAAGAAGGTTGTTGATCATTATGAAAATCCTAG
  AAACGTGGGGTCCCTTGACAAGACATCTAAAAATGTTGGAACTGGACTGGTGGGGGCTCCAGCATGTGGT
  GACGTAATGAAATTACAGATTCAAGTGGATGAAAAGGGGAAGATTGTGGATGCTAGGTTTAAAACATTTG
  GCTGTGGTTCCGCAATTGCCTCCAGCTCATTAGCCACTGAATGGGTGAAAGGAAAGACGGTGGAGGAAGC
  CTTGACTATCAAAAACACAGATATCGCCAAGGAGCTCTGCCTTCCTCCCGTGAAACTGCACTGCTCCAAA
  TCTGTGCTGTTTCCAGCAGAGGAGAAAACTCAGCTTTCGCCATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301140
• ORF Size: 465 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301140.1, NP_001288069.1
• RefSeq Size: 2234
• RefSeq ORF: 465
• Locus ID: 23479
• Gene Summary: This gene encodes a component of the iron-sulfur (Fe-S) cluster scaffold. Fe-S clusters are cofactors that play a role in the function of a diverse set of enzymes, including those that regulate metabolism, iron homeostasis, and oxidative stress response. Alternative splicing results in transcript variants encoding different protein isoforms that localize either to the cytosol or to the mitochondrion. Mutations in this gene have been found in patients with hereditary myopathy with lactic acidosis. A disease-associated mutation in an intron may activate a cryptic splice site, resulting in the production of a splice variant encoding a putatively non-functional protein. A pseudogene of this gene is present on chromosome 1. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (3) contains an alternate exon in the 3' region, resulting in a different 3' coding region and 3' UTR, compared to variant 2. Variants 3 and 5 encode the same protein (isoform 3), which has a distinct, shorter C-terminus, compared to isoform 2. Isoform 3 may not be stable (PMID:23035118). This variant may be preferentially produced in individuals containing an alternate intronic C vs G (rs767000507), which activates a cryptic splice acceptor site. The alternate C allele is associated with myopathy (PMIDs 18296749, 18304497).