AP2S1 (NM_001301078) Human Untagged Clone
CAT#: SC334021
AP2S1 (untagged) - Human adaptor-related protein complex 2, sigma 1 subunit (AP2S1), transcript variant 4
"NM_001301078" in other vectors (1)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | AP2S1 |
| Synonyms | AP17; CLAPS2; FBH3; FBHOk; HHC3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001301078, the custom clone sequence may differ by one or more nucleotides
ATGATCCGCTTTATCCTCATCCAGAACCGGGCAGGCAAGACGCGCCTGGCCAAGTGGTACATGCAGTTTG ATGATGATGAGAAACAGAAGCTGATCGAGGAGGTGCATGCCGTGGTCACCGTCCGAGACGCCAAACACAC CAACTTTGTGGAGGTCCTGGCAATCTCCGTTGCTGACAGCCTCTCTGTTCTGCAGTTCCGGAACTTTAAG ATCATTTACCGCCGCTATGCTGGCCTCTACTTCTGCATCTGTGTGGATGTCAATGACAACAACCTGGCTT ACCTGGAGGCCATTCACAACTTCGTGGAGGTCTTAAACGAATATTTCCACAATGTCTGTGAACTGGACCT GGTGTTCAACTTCTACAAGGTTTACACGGTCGTGGACGAGATGTTCCTGGCTGGCGAAATCCGAGAGACC AGCCAGACGAAGGTGCTGAAACAGCTGCTGATGCTACAGTCCCTGGAGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001301078 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001301078.1, NP_001288007.1 |
| RefSeq Size | 1007 bp |
| RefSeq ORF | 471 bp |
| Locus ID | 1175 |
| Cytogenetics | 19q13.32 |
| Protein Pathways | Endocytosis, Huntington's disease |
| Gene Summary | 'One of two major clathrin-associated adaptor complexes, AP-2, is a heterotetramer which is associated with the plasma membrane. This complex is composed of two large chains, a medium chain, and a small chain. This gene encodes the small chain of this complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]' Transcript Variant: This variant (4) contains an alternate 5' terminal exon, initiates translation at an alternate start codon and uses an alternate in-frame splice site in the 5' coding region, compared to variant 3. It encodes isoform 4, which is shorter and has a distinct N-terminus, compared to isoform 3. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC236127 | AP2S1 (myc-DDK-tagged) - Human adaptor-related protein complex 2, sigma 1 subunit (AP2S1), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China