CAPNS1 (NM_001302633) Human Untagged Clone

CAT#: SC334022

CAPNS1 (untagged) - Human calpain, small subunit 1 (CAPNS1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CAPNS1
• Synonyms: CALPAIN4; CANP; CANPS; CAPN4; CDPS; CSS1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302633, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGTCAGCGCCACAGAACTCATGAACATTCTCAATAAGGTTGTGACACGACACCCTGATCTGAAGA
  CTGATGGTTTTGGCATTGACACATGTCGCAGCATGGTGGCCGTGATGGATAGCGACACCACAGGCAAGCT
  GGGCTTTGAGGAATTCAAGTACTTGTGGAACAACATCAAAAGGTGGCAGGCCATATACAAACAGTTCGAC
  ACTGACCGATCAGGGACCATTTGCAGTAGTGAACTCCCAGGTGCCTTTGAGGCAGCAGGGTTCCACCTGA
  ATGAGCATCTCTATAACATGATCATCCGACGCTACTCAGATGAAAGTGGGAACATGGATTTTGACAACTT
  CATCAGCTGCTTGGTCAGGCTGGACGCCATGTTCCGTGCCTTCAAATCTCTTGACAAAGATGGCACTGGA
  CAAATCCAGGTGAACATCCAGGAGTGGCTGCAGCTGACTATGTATTCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302633
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302633.1, NP_001289562.1
• RefSeq Size: 1271 bp
• RefSeq ORF: 471 bp
• Locus ID: 826
• Cytogenetics: 19q13.12
• Protein Families: Druggable Genome, Protease
• Gene Summary: 'This gene is a member of the calpain small subunit family. Calpains are calcium-dependent cysteine proteinases that are widely distributed in mammalian cells. Calpains operate as heterodimers, comprising a specific large catalytic subunit (calpain 1 subunit in Calpain I, and calpain 2 subunit in Calpain II), and a common small regulatory subunit encoded by this gene. This encoded protein is essential for the stability and function of both calpain heterodimers, whose proteolytic activities influence various cellular functions including apoptosis, proliferation, migration, adhesion, and autophagy. Calpains have been implicated in neurodegenerative processes, such as myotonic dystrophy. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]'
  Transcript Variant: This variant (4) lacks two 5' exons and uses an alternate 5' terminal exon which results in the use of a downstream in-frame start codon, compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1.