ISCU (NM_001301141) Human Untagged Clone

CAT#: SC334024

ISCU (untagged) - Human iron-sulfur cluster assembly enzyme (ISCU), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ISCU
• Synonyms: 2310020H20Rik; HML; hnifU; ISU2; NIFU; NIFUN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301141, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCGGCTGGGGCTTTCCGTCTGAGGCGGGCGGCATCGGCTCTGCTGCTGCGGAGCCCCCGCCTGC
  CCGCCCGGGAGCTGTCGGCCCCGGCCCGACTCTATCACAAGAAGGTTGTTGATCATTATGAAAATCCTAG
  AAACGTGGGGTCCCTTGACAAGACATCTAAAAATGTTGGAACTGGACTGGTGGGGGCTCCAGCATGTGGT
  GACGTAATGAAATTACAGATTCAAGTGGATGAAAAGGGGAAGATTGTGGATGCTAGGTTTAAAACATTTG
  GCTGTGGTTCCGCAATTGCCTCCAGCTCATTAGCCACTGAATGGGTGAAAGGAAAGACGGTGGAGGAAGC
  CTTGACTATCAAAAACACAGATATCGCCAAGGAGCTCTGCCTTCCTCCCGTGAAACTGCACTGCTCCAGG
  AAAGAAGGAATGAGAAACATTAGCCTTAATGCATCGATGGAGGTTTACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301141
• ORF Size: 471 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301141.1, NP_001288070.1
• RefSeq Size: 2245
• RefSeq ORF: 471
• Locus ID: 23479
• Gene Summary: This gene encodes a component of the iron-sulfur (Fe-S) cluster scaffold. Fe-S clusters are cofactors that play a role in the function of a diverse set of enzymes, including those that regulate metabolism, iron homeostasis, and oxidative stress response. Alternative splicing results in transcript variants encoding different protein isoforms that localize either to the cytosol or to the mitochondrion. Mutations in this gene have been found in patients with hereditary myopathy with lactic acidosis. A disease-associated mutation in an intron may activate a cryptic splice site, resulting in the production of a splice variant encoding a putatively non-functional protein. A pseudogene of this gene is present on chromosome 1. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (4) contains an alternate exon in the 3' region, resulting in a different 3' coding region and 3' UTR, compared to variant 2. The encoded isoform (4) has a distinct, shorter C-terminus, compared to isoform 2.