BOC (NM_001301867) Human Untagged Clone

CAT#: SC334034

BOC (untagged) - Human BOC cell adhesion associated, oncogene regulated (BOC), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BOC
• Synonyms: CDON2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301867, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCGTGGGACGATGACGGCGTGGAGAGGAATGAGGCCTGAGGTCACACTGGCTTGCCTCCTCCTAG
  CCACAGCAGGCTGCTTTGCTGACTTGAACGAGGTCCCTCAGGTCACCGTCCAGCCTGCGTCCACCGTCCA
  GAAGCCCGGAGGCACTGTGATCTTGGGCTGCGTGGTGGAACCTCCAAGGATGAATGTAACCTGGCGCCTG
  AATGGAAAGGAGCTGAATGGCTCGGATGATGCTCTGGGTGTCCTCATCACCCACGGGACCCTCGTCATCA
  CTGCCCTTAACAACCACACTGTGGGACGGTACCAGTGTGTGGCCCGGATGCCTGCGGGGGCTGTGGCCAG
  CGTGCCAGCCACTGTGACACTAGCCAGTGAGTCTGCTCCTTTGCCTCCCTGCCATGGTGCGGTCCCTCCT
  CATCTCTCCCACCCTGAAGCCCCCACCATTCATGCTGCCTCTTGTTACTCTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301867
• ORF Size: 474 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301867.1, NP_001288796.1
• RefSeq Size: 1886
• RefSeq ORF: 474
• Locus ID: 91653
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: The protein encoded by this gene is a member of the immunoglobulin/fibronectin type III repeat family. It is a component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells, and promotes myogenic differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (3) lacks several exons and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1.