NMU (NM_001292045) Human Untagged Clone

CAT#: SC334044

NMU (untagged) - Human neuromedin U (NMU), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NMU
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001292045, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCGAACAGAGAGCTGCCGCCCCAGGTCGCCCGCCGGACAGGTGGCCGCGGCGTCCCCGCTCCTGC
  TGCTGCTGCTGCTGCTCGCCTGGTGCGCGGGCGCCTGCCGAGGTGCTCCAATATTACCTCAAGGATTACA
  GCCTGAACAACAGCTACAGTTGTGGAATGAGGCATCCAACGCACTGGAGGAGCTTTGCTTTATGATTATG
  GGAATGCTACCAAAGCCTCAGGAACAAGATGAAAAAGATAATACTAAAAGGTTCTTATTTCATTATTCGA
  AGACACAGAAGTTGGGCAAGTCAAATGTTGTGTCGTCAGTTGTGCATCCGTTGCTGCAGCTCGTTCCTCA
  CCTGCATGAGAGAAGAATGAAGAGATTCAGAGTGGACGAAGAATTCCAAAGTCCCTTTGCAAGTCAAAGT
  CGAGGATATTTTTTATTCAGGCCACGGAATGGAAGAAGGTCAGCAGGGTTCATTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001292045
• ORF Size: 477 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001292045.1, NP_001278974.1
• RefSeq Size: 786
• RefSeq ORF: 477
• Locus ID: 10874
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Gene Summary: This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in pain, stress, immune-mediated inflammatory diseases and feeding regulation. Increased expression of this gene was observed in renal, pancreatic and lung cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. Some of these isoforms may undergo similar processing to generate the mature peptide. [provided by RefSeq, Jul 2015]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter than isoform 1. This isoform (2) may undergo processing similar to isoform 1 to generate mature peptide.