NMU (NM_001292045) Human Untagged Clone

CAT#: SC334044

NMU (untagged) - Human neuromedin U (NMU), transcript variant 2


  "NM_001292045" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NMU
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001292045, the custom clone sequence may differ by one or more nucleotides


ATGCTGCGAACAGAGAGCTGCCGCCCCAGGTCGCCCGCCGGACAGGTGGCCGCGGCGTCCCCGCTCCTGC
TGCTGCTGCTGCTGCTCGCCTGGTGCGCGGGCGCCTGCCGAGGTGCTCCAATATTACCTCAAGGATTACA
GCCTGAACAACAGCTACAGTTGTGGAATGAGGCATCCAACGCACTGGAGGAGCTTTGCTTTATGATTATG
GGAATGCTACCAAAGCCTCAGGAACAAGATGAAAAAGATAATACTAAAAGGTTCTTATTTCATTATTCGA
AGACACAGAAGTTGGGCAAGTCAAATGTTGTGTCGTCAGTTGTGCATCCGTTGCTGCAGCTCGTTCCTCA
CCTGCATGAGAGAAGAATGAAGAGATTCAGAGTGGACGAAGAATTCCAAAGTCCCTTTGCAAGTCAAAGT
CGAGGATATTTTTTATTCAGGCCACGGAATGGAAGAAGGTCAGCAGGGTTCATTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001292045
ORF Size 477 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001292045.1, NP_001278974.1
RefSeq Size 786
RefSeq ORF 477
Locus ID 10874
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Gene Summary This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in pain, stress, immune-mediated inflammatory diseases and feeding regulation. Increased expression of this gene was observed in renal, pancreatic and lung cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. Some of these isoforms may undergo similar processing to generate the mature peptide. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter than isoform 1. This isoform (2) may undergo processing similar to isoform 1 to generate mature peptide.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.