DNA Primase (PRIM2) (NM_001282487) Human Untagged Clone

CAT#: SC334049

PRIM2 (untagged) - Human primase, DNA, polypeptide 2 (58kDa) (PRIM2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRIM2
• Synonyms: p58; PRIM2A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282487, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGTTTTCTGGAAGAAAGTGGAGGAAGCTGAGGTTGGCAGGTGACCAGAGGAATGCTTCCTACCCTC
  ATTGCCTTCAGTTTTACTTGCAGCCACCTTCTGAAAACATATCTTTAATAGAATTTGAAAACTTGGCTAT
  TGATAGAGTTAAATTGTTAAAATCAGTTGAAAATCTTGGAGTGAGCTATGTGAAAGGAACTGAACAATAC
  CAGAGTAAGTTGGAGAGTGAGCTTCGGAAGCTCAAGTTTTCCTACAGAGAAAACTTAGAAGATGAATATG
  AACCACGAAGAAGAGATCATATTTCTCATTTTATTTTGCGGCTTGCTTATTGCCAGTCTGAAGAACTTAG
  ACGCTGGTTCATTCAACAAGAAATGGATCTCCTTCGATTTAGATTTAGTATTTTACCCAAGGATAAAATT
  CAGGATTTCTTAAAGGATAGCCAATTGCAGTTTGAGGCTGTAAGTATATTTTTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282487
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282487.1, NP_001269416.1
• RefSeq Size: 871 bp
• RefSeq ORF: 477 bp
• Locus ID: 5558
• Cytogenetics: 6p11.2
• Protein Pathways: DNA replication, Metabolic pathways, Purine metabolism, Pyrimidine metabolism
• Gene Summary: 'This gene encodes the 58 kilodalton subunit of DNA primase, an enzyme that plays a key role in the replication of DNA. The encoded protein forms a heterodimer with a 49 kilodalton subunit. This heterodimer functions as a DNA-directed RNA polymerase to synthesize small RNA primers that are used to create Okazaki fragments on the lagging strand of the DNA. Alternative splicing of this gene results in multiple transcript variants. This gene has a related pseudogene, which is also present on chromosome 6. [provided by RefSeq, Apr 2014]'
  Transcript Variant: This variant (2) lacks multiple 3' coding exons and its 3' terminal exon extends past a splice site used in variant 1, resulting in a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a. Variants 2 and 3 encode the same isoform (b).