ABHD11 (NM_001301058) Human Untagged Clone

CAT#: SC334057

ABHD11 (untagged) - Human abhydrolase domain containing 11 (ABHD11), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ABHD11
• Synonyms: PP1226; WBSCR21
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301058, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGAGCCGGCCAACAGCTTGCAAGCATGCTCCGCTGGACCCGAGCCTGGAGGCTCCCGCGTGAGGGAC
  TCGGCCCCCACGGCCCTAGCTTCGCGAGGGTGCCTGTCGCACCCAGCAGCAGCAGCGGCGGCCGAGGGGG
  CGCCGAGCCGAGGCCGCTTCCGCTTTCCTACAGGCTTCTGGACGGGGAGGCAGCCCTCCCGGCCGTCGTC
  TTTTTGCACGGGCTCTTCGGCAGCAAAACTAACTTCAACTCCATCGCCAAGATCTTGGCCCAGCAGACAG
  GCCGTAGGGTGCTGACGGTGGATGCTCGTAACCACGGTGACAGCCCCCACAGCCCAGACATGAGCTACGA
  GATCATGAGCCAGGACCTGCAGGACCTTCTGCCCCAGCTGGGCCTGGTGCCCTGCGTCGTCGTTGGCCAC
  AGCATGGGAGGAAAGACAGCCATGCTGCTGGCACTACAGAGGTCCCAGCCACCACCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301058
• ORF Size: 480 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301058.1, NP_001287987.1
• RefSeq Size: 1142
• RefSeq ORF: 480
• Locus ID: 83451
• Gene Summary: This gene encodes a protein containing an alpha/beta hydrolase fold domain. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. [provided by RefSeq, Mar 2016]
  Transcript Variant: This variant (9) lacks two exons in the central coding region, which results in a frameshift, compared to variant 1. The encoded isoform (9) has a shorter and distinct C-terminus, compared to isoform 1.