CD99 (NM_001277710) Human Untagged Clone

CAT#: SC334068

CD99 (untagged) - Human CD99 molecule (CD99), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD99
• Synonyms: HBA71; MIC2; MIC2X; MIC2Y; MSK5X
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001277710, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCGCGGGGCTGCGCTGGCGCTGCTGCTCTTCGGCCTGCTGGGTGTTCTGGTCGCCGCCCCGGATG
  GTGGTTTCGATTTATCCGATGCCCTTCCTGACAATGAAAACAAGAAACCCACTGCAATCCCCAAGAAACC
  CAGTGCTGGGGATGACTTTGACTTAGGAGATGCTGTTGTTGATGGAGAAAATGACGACCCACGACCACCG
  AACCCACCCAAACCGATGCCAAATCCAAACCCCAACCACCCTAGTTCCTCCGGTAGCTTTTCAGATGCTG
  ACCTTGCGGATGGCGTTTCAGGTGGAGAAGGAAAAGGAGGCAGTGATGGTGGAGGCAGCCACAGGAAAGA
  AGGGGAAGAGGCCGACGCCCCAGGCGTGATCCCCGGGATTGTGGGGGCTGTCGTGGTCGCCGTGGCTGGA
  GCCATCTCTAGCTTCATTGCTTACCAGAAAAAGAAGCTATGCTTCAAAGAAAATGATGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277710
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001277710.1, NP_001264639.1
• RefSeq Size: 1270 bp
• RefSeq ORF: 483 bp
• Locus ID: 4267
• Cytogenetics: X;Y
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration
• Gene Summary: 'The protein encoded by this gene is a cell surface glycoprotein involved in leukocyte migration, T-cell adhesion, ganglioside GM1 and transmembrane protein transport, and T-cell death by a caspase-independent pathway. In addition, the encoded protein may have the ability to rearrange the actin cytoskeleton and may also act as an oncosuppressor in osteosarcoma. This gene is found in the pseudoautosomal region of chromosomes X and Y and escapes X-chromosome inactivation. There is a related pseudogene located immediately adjacent to this locus. [provided by RefSeq, Mar 2016]'
  Transcript Variant: This variant (3, also known as type II) contains an alternate internal exon in the 3' end and uses an alternate splice junction in the penultimate exon compared to variant 1. The additional exon contains an in-frame stop codon, making the resulting isoform (c, also known as CD99sh) have a shorter and distinct C-terminus compared to isoform a.