NMNAT1 (NM_001297779) Human Untagged Clone

CAT#: SC334069

NMNAT1 (untagged) - Human nicotinamide nucleotide adenylyltransferase 1 (NMNAT1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NMNAT1
• Synonyms: LCA9; NMNAT; PNAT1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297779, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAAATTCCGAGAAGACTGAAGTGGTTCTCCTTGCTTGTGGTTCATTCAATCCCATCACCAACATGC
  ACCTCAGGTTGTTTGAGCTGGCCAAGGACTACATGAATGGAACAGGAAGGTACACAGTTGTCAAAGGCAT
  CATCTCTCCTGTTGGTGATGCCTACAAGAAGAAAGGACTCATTCCTGCCTATCACCGGGTCATCATGGCA
  GAACTTGCTACCAAGAATTCTAAATGGGTGGAAGTTGATACATGGGAAAGTCTTCAGAAGGAGTGGAAAG
  AGACTCTGAAGGTGCTAAGACACCATCAAGAGAAATTGGAGGCTAGTGACTGTGATCACCAGCAGAACTC
  ACCTACTCTAGAAAGGCCTGGAAGGAAGAGGAAGTGGACTGAAACACAAGATTCTAGTCAAAAGAAATCC
  CTAGAGCCAAAAACAAAAGATGGAGTCTCGCTCTATCACCCAGGCTGGAGTGCAGTGGCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297779
• ORF Size: 483 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001297779.1, NP_001284708.1
• RefSeq Size: 1100
• RefSeq ORF: 483
• Locus ID: 64802
• Protein Pathways: Metabolic pathways, Nicotinate and nicotinamide metabolism
• Gene Summary: This gene encodes an enzyme which catalyzes a key step in the biosynthesis of nicotinamide adenine dinucleotide (NAD). The encoded enzyme is one of several nicotinamide nucleotide adenylyltransferases, and is specifically localized to the cell nucleus. Activity of this protein leads to the activation of a nuclear deacetylase that functions in the protection of damaged neurons. Mutations in this gene have been associated with Leber congenital amaurosis 9. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are located on chromosomes 1, 3, 4, 14, and 15. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (3) lacks an exon and contains an alternate 3' terminal exon, resulting in a different 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.