TMEM159 (NM_001301769) Human Untagged Clone

CAT#: SC334073

TMEM159 (untagged) - Human transmembrane protein 159 (TMEM159), transcript variant 3


  "NM_001301769" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TMEM159"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM159
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001301769, the custom clone sequence may differ by one or more nucleotides


ATGGCAAAAGAGGAGCCCCAGAGTATCTCAAGGGACTTGCAGGAACTGCAGAAGAAGCTGTCTCTGCTGA
TAGACTCCTTCCAGAATAACTCAAAGGTGGTGGCCTTTATGAAGTCTCCAGTGGGTCAGTACTTGGACAG
CCATCCGTTTCTGGCCTTCACCTTGCTGGTGTTCATTGTCATGTCGGCCGTTCCTGTTGGATTCTTCCTG
CTCATCGTGGTGCTTACCACCCTGGCTGCTCTGCTGGGGGTCATAATATTGGAAGGATTGGTCATCTCTG
TGGGTGGCTTCTCACTGCTCTGCATCCTCTGTGGTTTGGGCTTCGTATCACTCGCCATGTCGGGGATGAT
GATAGCATCTTATGTAGTGGTCTCCAGCCTCATCAGCTGCTGGTTTTCTCCCAGGCCACTGACACAGCAA
AACACCAGTTGTGACTTTCTGCCAGCCATGAAGTCTGCAGAATTCGAGGGGCTTTACCAGGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001301769
ORF Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001301769.1, NP_001288698.1
RefSeq Size 2072
RefSeq ORF 486
Locus ID 57146
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.