TAPA1 (CD81) (NM_001297649) Human Untagged Clone
CAT#: SC334093
CD81 (untagged) - Human CD81 molecule (CD81), transcript variant 2
"NM_001297649" in other vectors (1)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CD81 |
| Synonyms | CVID6; S5.7; TAPA1; TSPAN28 |
| Vector | PCMV6-Neo |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001297649, the custom clone sequence may differ by one or more nucleotides
ATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGGCCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCT TCACCTGCCTGGTCATCCTGTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCA GATCGCCAAGGATGTGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAAC AACGCCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGACTGCTT TGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCAGCAACCTCTTCAAGGA GGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGTACCTCATCGGCATTGCTGCCATCGTG GTCGCTGTGATCATGATCTTCGAGATGATCCTGAGCATGGTGCTGTGCTGTGGCATCCGGAACAGCTCCG TGTACTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001297649 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001297649.1, NP_001284578.1 |
| RefSeq Size | 1379 bp |
| RefSeq ORF | 498 bp |
| Locus ID | 975 |
| Cytogenetics | 11p15.5 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transmembrane |
| Protein Pathways | B cell receptor signaling pathway |
| Gene Summary | 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This protein appears to promote muscle cell fusion and support myotube maintenance. Also it may be involved in signal transduction. This gene is localized in the tumor-suppressor gene region and thus it is a candidate gene for malignancies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]' Transcript Variant: This variant (2) uses an alternate first exon and initiates translation at an alternate start codon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC236199 | CD81 (myc-DDK-tagged) - Human CD81 molecule (CD81), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China