CLEC5A (NM_001301167) Human Untagged Clone

CAT#: SC334098

CLEC5A (untagged) - Human C-type lectin domain family 5, member A (CLEC5A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLEC5A
• Synonyms: CLECSF5; MDL-1; MDL1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301167, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACTGGCACATGATCATCTCTGGGCTTATTGTGGTAGTGCTTAAAGTTGTTGGAATGACCTTATTTC
  TACTTTATTTCCCACAGATTTTTAACAAAAGTAACGATGGTTTCACCACCACCAGGAGCTATGGAACAGT
  CTGCCCCAAAGACTGGGAATTTTATCAAGCAAGATGTTTTTTCTTATCCACTTCTGAATCATCTTGGAAT
  GAAAGCAGGGACTTTTGCAAAGGAAAAGGATCCACATTGGCAATTGTCAACACGCCAGAGAAACTGAAGT
  TTCTTCAGGACATAACTGATGCTGAGAAGTATTTTATTGGCTTAATTTACCATCGTGAAGAGAAAAGGTG
  GCGTTGGATCAACAACTCTGTGTTCAATGGCAATGTTACCAATCAGAATCAGAATTTCAACTGTGCGACC
  ATTGGCCTAACAAAGACATTTGATGCTGCATCATGTGACATCAGCTACCGCAGGATCTGTGAGAAGAATG
  CCAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301167
• ORF Size: 498 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301167.1, NP_001288096.1
• RefSeq Size: 3466
• RefSeq ORF: 498
• Locus ID: 23601
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein interacts with dnax-activation protein 12 and may play a role in cell activation. Alternative splice variants have been described but their full-length sequence has not been determined. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.