FGF22 (NM_001300812) Human Untagged Clone

CAT#: SC334099

FGF22 (untagged) - Human fibroblast growth factor 22 (FGF22), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FGF22
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300812, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGCCGCCGCCTGTGGCTGGGCCTGGCCTGGCTGCTGCTGGCGCGGGCGCCGGACGCCGCGGGAACCC
  CGAGCGCGTCGCGGGGACCGCGCAGCTACCCGCACCTGGAGGGCGACGTGCGCTGGCGGCGCCTCTTCTC
  CTCCACTCACTTCTTCCTGCGCGTGGATCCCGGCGGCCGCGTGCAGGGCACCCGCTGGCGCCACGGCCAG
  GACAGCATCCTGGAGATCCGCTCTGTACACGTGGGCGTCGTGGTCATCAAAGCAGTGTCCTCAGGCTTCT
  ACGTGGCCATGAACCGCCGGGGCCGCCTCTACGGGTCGGTTCCGGGAGCGCATCGAAGAGAACGGCCACA
  ACACCTACGCCTCACAGCGCTGGCGCCGCCGCGGCCAGCCCATGTTCCTGGCGCTGGACAGGAGGGGGGG
  GCCCCGGCCAGGCGGCCGGACGCGGCGGTACCACCTGTCCGCCCACTTCCTGCCCGTCCTGGTCTCCTGA
  GGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300812
• ORF Size: 498 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300812.1, NP_001287741.1
• RefSeq Size: 620
• RefSeq ORF: 498
• Locus ID: 27006
• Protein Families: Secreted Protein
• Protein Pathways: MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
• Gene Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The mouse homolog of this gene was found to be preferentially expressed in the inner root sheath of the hair follicle, which suggested a role in hair development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.