Lysophospholipase 1 (LYPLA1) (NM_001279360) Human Untagged Clone

CAT#: SC334102

LYPLA1 (untagged) - Human lysophospholipase I (LYPLA1), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LYPLA1
• Synonyms: APT-1; APT1; hAPT1; LPL-I; LPL1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001279360, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACGTGGCTATGCCTTCATGGTTTGATATTATTGGGCTTTCACCAGATTCACAGGAGGATGAATCTG
  GGATTAAACAGGCAGCAGAAAATATAAAAGCTTTGATTGATCAAGAAGTGAAGAATGGCATTCCTTCTAA
  CAGAATTATTTTGGGAGGGTTTTCTCAGGGAGGAGCTTTATCTTTATATACTGCCCTTACCACACAGCAG
  AAACTGGCAGGTGTCACTGCACTCAGTTGCTGGCTTCCACTTCGGGCTTCCTTTCCACAGGGTCCTATCG
  GTGGTGCTAATAGAGATATTTCTATTCTCCAGTGCCACGGGGATTGTGACCCTTTGGTTCCCCTGATGTT
  TGGTTCTCTTACGGTGGAAAAACTAAAAACATTGGTGAATCCAGCCAATGTGACCTTTAAAACCTATGAA
  GGTATGATGCACAGTTCGTGTCAACAGGAAATGATGGATGTCAAGCAATTCATTGATAAACTCCTACCTC
  CAATTGATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001279360
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001279360.1, NP_001266289.1
• RefSeq Size: 2538
• RefSeq ORF: 501
• Locus ID: 10434
• Protein Pathways: Glycerophospholipid metabolism
• Gene Summary: This gene encodes a member of the alpha/beta hydrolase superfamily. The encoded protein functions as a homodimer, exhibiting both depalmitoylating as well as lysophospholipase activity, and may be involved in Ras localization and signaling. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 4, 6, and 7. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (6) uses an alternate 5'-terminal exon, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (6) has a shorter N-terminus, compared to isoform 1.