TNFAIP8 (NM_001286817) Human Untagged Clone

CAT#: SC334105

TNFAIP8 (untagged) - Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNFAIP8
• Synonyms: GG2-1; MDC-3.13; NDED; SCC-S2; SCCS2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001286817, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGTCCAAATCCATCGCCACCACCTTAATAGACGACACAAGTAGTGAGGTGCTGGATGAGCTCTACA
  GAGTGACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAGAAGATCATCAAGAACCTCATCAAGACAGT
  CATCAAGCTGGCCATTCTTTATAGGAATAATCAGTTTAATCAAGATGAGCTAGCATTGATGGAGAAATTT
  AAGAAGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGTTTCCATCAGGTGGATTATACCTTTGACCGGA
  ATGTGTTATCCAGGCTGTTAAATGAATGCAGAGAGATGCTGCACCAAATCATTCAGCGCCACCTCACTGC
  CAAGTCACATGGACGGGTTAATAATGTGTTTGATCATTTTTCAGATTGTGAATTTTTGGCTGCCTTGTAT
  AATCCTTTTGGGAATTTTAAACCCCACTTACAAAAACTATGTGATGGTATCAACAAAATGTTGGATGAAG
  AGAACATATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286817
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001286817.1, NP_001273746.1
• RefSeq Size: 2139
• RefSeq ORF: 501
• Locus ID: 25816
• Protein Families: Druggable Genome
• Gene Summary: Acts as a negative mediator of apoptosis and may play a role in tumor progression. Suppresses the TNF-mediated apoptosis by inhibiting caspase-8 activity but not the processing of procaspase-8, subsequently resulting in inhibition of BID cleavage and caspase-3 activation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (6) differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (d) has a shorter N-terminus, compared to isoform a. Both variants 5 and 6 encode the same isoform.