TNFAIP8 (NM_001286817) Human Untagged Clone

CAT#: SC334105

TNFAIP8 (untagged) - Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 6


  "NM_001286817" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TNFAIP8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TNFAIP8
Synonyms GG2-1; MDC-3.13; NDED; SCC-S2; SCCS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286817, the custom clone sequence may differ by one or more nucleotides


ATGGTGTCCAAATCCATCGCCACCACCTTAATAGACGACACAAGTAGTGAGGTGCTGGATGAGCTCTACA
GAGTGACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAGAAGATCATCAAGAACCTCATCAAGACAGT
CATCAAGCTGGCCATTCTTTATAGGAATAATCAGTTTAATCAAGATGAGCTAGCATTGATGGAGAAATTT
AAGAAGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGTTTCCATCAGGTGGATTATACCTTTGACCGGA
ATGTGTTATCCAGGCTGTTAAATGAATGCAGAGAGATGCTGCACCAAATCATTCAGCGCCACCTCACTGC
CAAGTCACATGGACGGGTTAATAATGTGTTTGATCATTTTTCAGATTGTGAATTTTTGGCTGCCTTGTAT
AATCCTTTTGGGAATTTTAAACCCCACTTACAAAAACTATGTGATGGTATCAACAAAATGTTGGATGAAG
AGAACATATGA


Restriction Sites SgfI-MluI     
ACCN NM_001286817
ORF Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001286817.1, NP_001273746.1
RefSeq Size 2139
RefSeq ORF 501
Locus ID 25816
Protein Families Druggable Genome
Gene Summary Acts as a negative mediator of apoptosis and may play a role in tumor progression. Suppresses the TNF-mediated apoptosis by inhibiting caspase-8 activity but not the processing of procaspase-8, subsequently resulting in inhibition of BID cleavage and caspase-3 activation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (d) has a shorter N-terminus, compared to isoform a. Both variants 5 and 6 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.