CDIPT (NM_001286585) Human Untagged Clone

CAT#: SC334117

CDIPT (untagged) - Human CDP-diacylglycerol--inositol 3-phosphatidyltransferase (CDIPT), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDIPT
• Synonyms: PIS; PIS1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001286585, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCAGACGAAAATATCTTCCTGTTCGTGCCCAACCTCATCGGAACCCGGTTTGGGGCCATGCTGGACA
  TGCTGACGGACCGCTGCTCCACCATGTGCCTGTTGGTCAACCTGGCCCTGCTGTACCCTGGAGCCACGCT
  GTTCTTCCAAATCAGCATGAGTTTGGATGTGGCCAGTCACTGGCTGCACCTCCACAGTTCTGTGGTCCGA
  GGCAGTGAGAGTCACAAGATGATCGACTTGTCCGGGAATCCGGTGCTTCGGATCTACTACACCTCGAGGC
  CTGCTCTGTTCACCTTGTGTGCTGGGAATGAGCTCTTCTACTGCCTCCTCTACCTGTTCCATTTCTCTGA
  GGGACCTTTAGTTGGCTCTGTGGGACTGTTCCGGATGGGCCTCTGGGTCACTGCCCCCATCGCCTTGCTG
  AAGTCGCTCATCAGCGTCATCCACCTGATCACGGCCGCCCGCAACATGGCTGCCCTGGACGCAGCAGACC
  GCGCCAAGAAGAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286585
• ORF Size: 507 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001286585.1, NP_001273514.1
• RefSeq Size: 1793
• RefSeq ORF: 507
• Locus ID: 10423
• Protein Families: Transmembrane
• Protein Pathways: Glycerophospholipid metabolism, Inositol phosphate metabolism, Metabolic pathways, Phosphatidylinositol signaling system
• Gene Summary: Phosphatidylinositol breakdown products are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. Two enzymes, CDP-diacylglycerol synthase and phosphatidylinositol synthase, are involved in the biosynthesis of phosphatidylinositol. Phosphatidylinositol synthase, a member of the CDP-alcohol phosphatidyl transferase class-I family, is an integral membrane protein found on the cytoplasmic side of the endoplasmic reticulum and the Golgi apparatus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' end compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.