Neuritin (NRN1) (NM_001278711) Human Untagged Clone

CAT#: SC334120

NRN1 (untagged) - Human neuritin 1 (NRN1), transcript variant 3


  "NM_001278711" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "NRN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NRN1
Synonyms dJ380B8.2; NRN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278711, the custom clone sequence may differ by one or more nucleotides


ATGGCCACAGCCGCGCGCCCGCAGCCTGACCACTCATCATCCGCGCCAGGTCTCAGGACGTCCAGGCTGC
CCTCTTTCCAGCGGGGCGGGAGAGGGTGCATCCGAGGGTCTCACTCGGAATACAGAGTCCACGCGTATCT
GGTGCAGGCCGTGAGAGCAGCGGGCAAGTGCGATGCGGTCTTCAAGGGCTTTTCGGACTGTTTGCTCAAG
CTGGGCGACAGCATGGCCAACTACCCGCAGGGCCTGGACGACAAGACGAACATCAAGACCGTGTGCACAT
ACTGGGAGGATTTCCACAGCTGCACGGTCACAGCCCTTACGGATTGCCAGGAAGGGGCGAAAGATATGTG
GGATAAACTGAGAAAAGAATCCAAAAACCTCAACATCCAAGGCAGCTTATTCGAACTCTGCGGCAGCGGC
AACGGGGCGGCGGGGTCCCTGCTCCCGGCGTTCCCGGTGCTCCTGGTGTCTCTCTCGGCAGCTTTAGCGA
CCTGGCTTTCCTTCTGA


Restriction Sites SgfI-RsrII     
ACCN NM_001278711
ORF Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001278711.1, NP_001265640.1
RefSeq Size 1813
RefSeq ORF 507
Locus ID 51299
Gene Summary This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) differs in its 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The encoded isoform (2) has a longer and distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.