PLGF (PGF) (NM_001293643) Human Untagged Clone

CAT#: SC334128

PGF (untagged) - Human placental growth factor (PGF), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGF
• Synonyms: D12S1900; PGFL; PIGF; PLGF; PlGF-2; SHGC-10760
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001293643, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGGTCATGAGGCTGTTCCCTTGCTTCCTGCAGCTCCTGGCCGGGCTGGCGCTGCCTGCTGTGCCCC
  CCCAGTGGGCCTTGTCTGCTGGGAACGGCTCGTCAGAGGTGGAAGTGGTACCCTTCCAGGAAGTGTGGGG
  CCGCAGCTACTGCCGGGCGCTGGAGAGGCTGGTGGACGTCGTGTCCGAGTACCCCAGCGAGGTGGAGCAC
  ATGTTCAGCCCATCCTGTGTCTCCCTGCTGCGCTGCACCGGCTGCTGCGGCGATGAGAATCTGCACTGTG
  TGCCGGTGGAGACGGCCAATGTCACCATGCAGCTCCTAAAGATCCGTTCTGGGGACCGGCCCTCCTACGT
  GGAGCTGACGTTCTCTCAGCACGTTCGCTGCGAATGCCGGCCTCTGCGGGAGAAGATGAAGCCGGAAAGG
  AGGAGACCCAAGGGCAGGGGGAAGAGGAGGAGAGAGAAGCAGAGACCCACAGACTGCCACCTGTGCGGCG
  ATGCTGTTCCCCGGAGGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293643
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293643.1, NP_001280572.1
• RefSeq Size: 1908 bp
• RefSeq ORF: 510 bp
• Locus ID: 5228
• Cytogenetics: 14q24.3
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Bladder cancer, Focal adhesion, mTOR signaling pathway, Pancreatic cancer, Pathways in cancer, Renal cell carcinoma
• Gene Summary: 'This gene encodes a growth factor found in placenta which is homologous to vascular endothelial growth factor. Alternatively spliced transcripts encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]'
  Transcript Variant: This variant (3) has an alternate splice site in the 5' coding region, compared to variant 1. The resulting isoform (3) lacks an internal aa, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.