CABP4 (NM_001300895) Human Untagged Clone

CAT#: SC334139

CABP4 (untagged) - Human calcium binding protein 4 (CABP4), transcript variant 2


  "NM_001300895" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
CABP4 mouse monoclonal antibody, clone OTI9A7 (formerly 9A7)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CABP4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CABP4
Synonyms CRSD; CSNB2B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334139 representing NM_001300895.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAGAGCCGTGGCTGGCCCTGGGGACATCCTGGACTCTCCCCCTGCAGGACCGCGAACTGGGCCCC
GAGGAGCTAGACGAGCTTCAGGCCGCCTTCGAGGAGTTTGACACTGACCGTGACGGCTACATCAGCCAC
CGGGAGCTGGGTGACTGCATGCGGACCCTGGGCTACATGCCCACCGAGATGGAGCTCCTGGAGGTCTCG
CAGCACATCAAGATGCGCATGGGCGGCCGTGTGGACTTTGAGGAGTTTGTAGAACTGATAGGCCCAAAG
CTGAGGGAGGAGACGGCGCACATGCTGGGGGTGCGAGAGCTGCGCATCGCCTTCCGAGAGTTTGACAGG
GACAGGGATGGACGAATTACGGTGGCGGAGCTGCGGGAGGCGGTACCGGCTCTGCTCGGGGAGCCGCTG
GCGGGTCCTGAGCTGGACGAGATGCTCCGAGAAGTGGACCTCAATGGGGATGGCACCGTAGACTTTGAC
GAGTTTGTGATGATGCTCTCCCGCCACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001300895
Insert Size 513 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300895.1
RefSeq Size 4104 bp
RefSeq ORF 513 bp
Locus ID 57010
UniProt ID P57796
Cytogenetics 11q13.2
MW 19.6 kDa
Gene Summary This gene encodes a member of the CABP family of calcium binding protein characterized by four EF-hand motifs. Mutations in this gene are associated with congenital stationary night blindness type 2B. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.