CABP4 (NM_001300896) Human Untagged Clone

CAT#: SC334140

CABP4 (untagged) - Human calcium binding protein 4 (CABP4), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CABP4
• Synonyms: CRSD; CSNB2B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334140 representing NM_001300896.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACAGAGCCGTGGCTGGCCCTGGGGACATCCTGGACTCTCCCCCTGCAGGACCGCGAACTGGGCCCC
  GAGGAGCTAGACGAGCTTCAGGCCGCCTTCGAGGAGTTTGACACTGACCGTGACGGCTACATCAGCCAC
  CGGGAGCTGGGTGACTGCATGCGGACCCTGGGCTACATGCCCACCGAGATGGAGCTCCTGGAGGTCTCG
  CAGCACATCAAGATGCGCATGGGCGGCCGTGTGGACTTTGAGGAGTTTGTAGAACTGATAGGCCCAAAG
  CTGAGGGAGGAGACGGCGCACATGCTGGGGGTGCGAGAGCTGCGCATCGCCTTCCGAGAGTTTGACAGG
  GACAGGGATGGACGAATTACGGTGGCGGAGCTGCGGGAGGCGGTACCGGCTCTGCTCGGGGAGCCGCTG
  GCGGGTCCTGAGCTGGACGAGATGCTCCGAGAAGTGGACCTCAATGGGGATGGCACCGTAGACTTTGAC
  GAGTTTGTGATGATGCTCTCCCGCCACTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001300896
• Insert Size: 513 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300896.1
• RefSeq Size: 3988 bp
• RefSeq ORF: 513 bp
• Locus ID: 57010
• UniProt ID: P57796
• Cytogenetics: 11q13.2
• MW: 19.6 kDa
• Gene Summary: This gene encodes a member of the CABP family of calcium binding protein characterized by four EF-hand motifs. Mutations in this gene are associated with congenital stationary night blindness type 2B. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.