RAG1AP1 (SLC50A1) (NM_001287586) Human Untagged Clone

CAT#: SC334183

SLC50A1 (untagged) - Human solute carrier family 50 (sugar efflux transporter), member 1 (SLC50A1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC50A1
• Synonyms: HsSWEET1; RAG1AP1; SCP; slv; SWEET1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334183 representing NM_001287586.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCGTGGTCTTCACCCTTGCAACCTGGGCTGGCTGAGTTATGGGGCTTTGAAGGGAGACGGGATCCTC
  ATCGTCGTCAACACAGTGGGTGCTGCGCTTCAGACCCTGTATATCTTGGCATATCTGCATTACTGCCCT
  CGGAAGCGTGTTGTGCTCCTACAGACTGCAACCCTGCTAGGGGTCCTTCTCCTGGGTTATGGCTACTTT
  TGGCTCCTGGTACCCAACCCTGAGGCCCGGCTTCAGCAGTTGGGCCTCTTCTGCAGTGTCTTCACCATC
  AGCATGTACCTCTCACCACTGGCTGACTTGGCTAAGGTGATTCAAACTAAATCAACCCAATGTCTCTCC
  TACCCACTCACCATTGCTACCCTTCTCACCTCTGCCTCCTGGTGCCTCTATGGGTTTCGACTCAGAGAT
  CCCTATATCATGGTGTCCAACTTTCCAGGAATCGTCACCAGCTTTATCCGCTTCTGGCTTTTCTGGAAG
  TACCCCCAGGAGCAAGACAGGAACTACTGGCTCCTGCAAACCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001287586
• Insert Size: 528 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287586.1
• RefSeq Size: 1266 bp
• RefSeq ORF: 528 bp
• Locus ID: 55974
• UniProt ID: Q9BRV3
• Cytogenetics: 1q22
• Protein Families: Transmembrane
• MW: 20 kDa
• Gene Summary: Mediates sugar transport across membranes. May stimulate V(D)J recombination by the activation of RAG1.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) uses an alternate splice junction at the 3' end of the first exon and lacks an alternate in-frame 5' coding exon compared to variant 1. The resulting isoform (d) has a shorter and distinct N-terminus compared to isoform a.