C22orf25 (TANGO2) (NM_001283235) Human Untagged Clone

CAT#: SC334202

TANGO2 (untagged) - Human transport and golgi organization 2 homolog (Drosophila) (TANGO2), transcript variant 11


  "NM_001283235" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-TANGO2 Antibody
    • 100 ul

USD 375.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "TANGO2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TANGO2
Synonyms C22orf25; MECRCN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334202 representing NM_001283235.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGGGCATCAGCACACGTGGCAAGCTGGCAGCACTCACCAACTACCTGCAGCCGCAGCTGGACTG
GCAGGCCCGAGGGCGAGCACAGCAAAGGGAGACGTCATTTGCTACTATGGGAACCGAGGGGAGCCTGAT
CCTATCGTTTTGACGCCAGGCACCTACGGGCTGAGCAACGCGCTGCTGGAGACTCCCTGGAGGAAGCTG
TGCTTTGGGAAGCAGCTCTTCCTGGAGGCTGTGGAACGGAGCCAGGCGCTGCCCAAGGATGTGCTCATC
GCCAGCCTCCTGGATGTGCTCAACAATGAAGAGGCGCAGCTGCCAGACCCGGCCATCGAGGACCAGGGT
GGGGAGTACGTGCAGCCCATGCTGAGCAAGTACGCGGCTGTGTGCGTGCGCTGCCCTGGCTACGGCACC
AGAACCAACACTATCATCCTGGTAGATGCGGACGGCCACGTGACCTTCACTGAGCGTAGCATGATGGAC
AAGGACCTCTCCCACTGGGAGACCAGAACCTATGAGTTCACACTGCAGAGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001283235
Insert Size 537 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001283235.2
RefSeq Size 3323 bp
RefSeq ORF 537 bp
Locus ID 128989
UniProt ID Q6ICL3
Cytogenetics 22q11.21
MW 19.5 kDa
Gene Summary This gene belongs to the transport and Golgi organization family, whose members are predicted to play roles in secretory protein loading in the endoplasmic reticulum. Depletion of this gene in Drosophila S2 cells causes fusion of the Golgi with the ER. In mouse tissue culture cells, this protein co-localizes with a mitochondrially targeted mCherry protein and displays very low levels of co-localization with Golgi and peroxisomes. Allelic variants of this gene are associated with rhabdomyolysis, metabolic crises with encephalopathy, and cardiac arrhythmia. [provided by RefSeq, Apr 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.