p21 ARC (ARPC3) (NM_001278556) Human Untagged Clone

CAT#: SC334204

ARPC3 (untagged) - Human actin related protein 2/3 complex, subunit 3, 21kDa (ARPC3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARPC3
• Synonyms: ARC21; p21-Arc
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334204 representing NM_001278556.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCGGCTTACCACTCTTCTCTCATGGATCCTGATACCAAACTCATCGGAAACATGGCACTGTTGCCT
  ATCAGAAGTCAATTCAAAGGACCTGCCCCCAGAGAGACAAAAGATACAGATATTGTGGATGAAGCCATC
  TATTACTTCAAGGCCAATGTCTTCTTCAAAAACTATGAAATTAAGAATGAAGCTGATAGGACCTTGATA
  TATATAACTCTCTACATTTCTGAATGTCTGAAGAAACTGCAAAAGTGCAATTCCAAAAGCCAAGGTGAG
  AAAGAAATGTATACGCTGGGAATCACTAATTTTCCCATTCCTGGAGAGCCTGGTTTTCCACTTAACGCA
  ATTTATGCCAAACCTGCAAACAAACAGGAAGATGAAGTGATGAGAGCCTATTTACAACAGCTAAGGCAA
  GAGACTGGACTGAGACTTTGTGAGAAAGTTTTCGACCCTCAGAATGATAAACCCAGCAAGTGGTGGACT
  TGCTTTGTGAAGAGACAGTTCATGAACAAGAGTCTTTCAGGACCTGGACAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278556
• Insert Size: 537 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278556.1
• RefSeq Size: 962 bp
• RefSeq ORF: 537 bp
• Locus ID: 10094
• UniProt ID: O15145
• Cytogenetics: 12q24.11
• Protein Pathways: Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton
• MW: 20.5 kDa
• Gene Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been conserved through evolution and is implicated in the control of actin polymerization in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
  Transcript Variant: This variant (1) encodes the longer isoform (1).