BTD (NM_001281726) Human Untagged Clone

CAT#: SC334208

BTD (untagged) - Human biotinidase (BTD), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BTD
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334208 representing NM_001281726.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGCATGCGCATATTCAGGGCGGAAGGCGCGCTAAGAGCAGATTTGTGGTCTGCATTATGTCTGGA
  GCCAGAAGTAAGCTTGCTCTTTTCCTCTGCGGCTGTTACGTGGTTGCCCTGGGAGCCCACACCGGGGAG
  GAGAGCGTGGCTGACCATCACGAGGCTGAATATTATGTGGCTGCCGTGTATGAGCATCCATCCATCCTG
  AGTCTGAACCCTCTGGCTCTCATCAGCCGCCAAGAGGCCTTGGAGCTCATGAACCAGAACCTTGACATC
  TATGAACAGCAAGTGATGACTGCAGCCCAAAAGGATGTACAGATTATAGTGTTTCCAGAAGATGGCATT
  CATGGATTCAACTTTACAAGAACATCCATTTATCCATTTTTGGACTTCATGCCGTCTCCCCAGGTGGTC
  AGGTGGAACCCATGCCTGGAGCCTCACCGCTTCAATGACACAGAGGTGATTCCTGCCTTTTTCCTCAGT
  AGGCTGAGGGTACACAGAGGTGATCTAAGTCAGGGACCAGAAGCTGTGACATGTTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001281726
• Insert Size: 540 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001281726.1
• RefSeq Size: 769 bp
• RefSeq ORF: 540 bp
• Locus ID: 686
• Cytogenetics: 3p25.1
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Biotin metabolism, Metabolic pathways
• MW: 20.1 kDa
• Gene Summary: The protein encoded by this gene functions to recycle protein-bound biotin by cleaving biocytin (biotin-epsilon-lysine), a normal product of carboxylase degradation, resulting in regeneration of free biotin. The encoded protein has also been shown to have biotinyl transferase activity. Mutations in this gene are associated with biotinidase deficiency. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (5) has multiple differences compared to variant 1, one of which results in a translational frameshift. The resulting protein (isoform 5) is shorter and has distinct N- and C-termini compared to isoform 1.