SLC66A1 (NM_001287531) Human Untagged Clone

CAT#: SC334212

PQLC2 (untagged) - Human PQ loop repeat containing 2 (PQLC2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC66A1
• Synonyms: LAAT-1; LAAT1; PQLC2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334212 representing NM_001287531.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCTGACGCTGTACTTTTACTACAAGTTCAGGACGCGCCCCTCTCTGTTGTCTGCCCCCATCAACTCC
  GTGCTGTTGTTCCTCATGGGGATGGCGTGCGCCACACCGCTGCTGAGTGCTGCTGGGCCCGTGGCTGCC
  CCTAGGGAAGCCTTCCGGGGGCGGGCGCTCCTGTCCGTGGAGTCGGGCAGCAAGCCCTTCACCCGGCAG
  GAAGTCATTGGCTTCGTCATCGGCTCCATCTCCAGCGTGTTGTACCTGCTTTCCCGGCTGCCTCAGATC
  CGCACCAACTTCCTCCGGAAGTCCACCCAGGGGATCTCCTACTCTCTGTTCGCGCTGGTGATGCTGGGG
  AACACGCTGTATGGGCTGAGCGTGCTGCTCAAAAACCCCGAGGAGGGCCAGAGCGAGGGCAGCTACCTG
  CTGCACCACCTGCCCTGGCTTGTGGGCAGCCTGGGCGTGCTGCTGCTCGACACCATCATCTCCATCCAG
  TTCCTGGTGTACAGGCGCAGCACCGCCGCCTCGGAGCTTGAGCCCCTCCTCCCCAGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001287531
• Insert Size: 543 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287531.1
• RefSeq Size: 1636 bp
• RefSeq ORF: 543 bp
• Locus ID: 54896
• UniProt ID: Q6ZP29
• Cytogenetics: 1p36.13
• Protein Families: Transmembrane
• MW: 19.8 kDa
• Gene Summary: Amino acid transporter that specifically mediates the pH-dependent export of the cationic amino acids arginine, histidine and lysine from lysosomes.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) lacks an alternate segment in the 5' UTR, an alternate exon, and uses an alternate splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1.